View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_high_20 (Length: 247)
Name: NF16065_high_20
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 91 - 234
Target Start/End: Complemental strand, 40801556 - 40801413
Alignment:
| Q |
91 |
gtgagaaaaagttcaaaggaatgtgagaatgattcattacaaatctctaaagatttggcaccaattaaatgagaggctaaaatatatcgaaatattatgg |
190 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40801556 |
gtgagaaaaagttcaaagggatgtgagaatgattcattacaaatctctaaagatttggcaccaattaaatgagaggctaaaatatctcgaaatattatgg |
40801457 |
T |
 |
| Q |
191 |
accattaattcaataagacaatggtctttctgtatagcatatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801456 |
accattaattcaataagacaatggtctttctgtatagcatatgt |
40801413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 17 - 77
Target Start/End: Complemental strand, 40801640 - 40801580
Alignment:
| Q |
17 |
aagctacatattggaatcaacatatttatttatgtgaatgagttccacatgaatgaagggg |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40801640 |
aagctacatattggaatcaacatatttatttatgtgaatgagttccacatgaatgaagggg |
40801580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University