View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_low_22 (Length: 263)
Name: NF16065_low_22
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 28937841 - 28938068
Alignment:
| Q |
17 |
cataggcatcggagaggggcaaggggcaagaggcaagggagcagagtgattcaatgacatacattttgactagtaatttacaatagtaccaccattatta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28937841 |
cataggcatcggagaggggcaaggggcaagaggcaagggagcagagtgattcaatgacatacattttgactagtaatttacaatagtaccgccattatta |
28937940 |
T |
|
| Q |
117 |
actcgagtcctgacctcatgcacttcaactgacttgtagatatgtggacaagaacattcaacaaaaatacagattcaagcaagacaaacaacacatgtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28937941 |
actcgagtcctgacctcatgcacttcaactgacttgtagatatgtggacaagaacattcaacaaaaatacagattcaaacaagacaaacaacacatgtgt |
28938040 |
T |
|
| Q |
217 |
tctacattattgaacaactcaatcaaac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28938041 |
tctacattattgaacaactcaatcaaac |
28938068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University