View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_low_24 (Length: 231)
Name: NF16065_low_24
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 30076717 - 30076578
Alignment:
| Q |
9 |
tgagaagaacatgatggaacaactcatgttttttcttagcttgcaaatcaaacaatattttgatggtattttcatctgttaagaaaaatatgtcaaagat |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30076717 |
tgagatgaacatgatggaacaactcatgttttt-cttagcttgcaaatcaaacaacattttaatggtattttcatctgttaagaaaaatatgtcaaagat |
30076619 |
T |
 |
| Q |
109 |
atttttaagaagctcaaaatgaatgaagttgagatcatgac |
149 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30076618 |
atttttaagaagttcaaaatgaatgaagttgagatcatgac |
30076578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 146 - 231
Target Start/End: Original strand, 28937951 - 28938036
Alignment:
| Q |
146 |
tgacctcatgcacttcaactgcattttagatatgtagcccagagcattcaacaaaaattcataatcaagcaaaacaaacaacacat |
231 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| | | ||| |||||||||||||| || | |||| ||| ||||||||||||| |
|
|
| T |
28937951 |
tgacctcatgcacttcaactgacttgtagatatgtggacaagaacattcaacaaaaatacagattcaaacaagacaaacaacacat |
28938036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University