View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_low_25 (Length: 227)
Name: NF16065_low_25
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 28937751 - 28937578
Alignment:
| Q |
1 |
agattatgtacttctgaacgaattgaaagaaagaaaaaggagaaatagagatgtaannnnnnnnnnnnnnnnnngaagttagatatagataaccctgaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28937751 |
agattatgtacttctgaacgaattgaaagaaagaaaaaggagaaatagagatgtaattttttttaagtttttt-gaagttagatatagataaccctgaga |
28937653 |
T |
|
| Q |
101 |
cgattgaacactgttgagcatggcctagtgcttaagaataccgcaatcatgaaagacaatgagtgcaaccatccc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28937652 |
cgattgaacactgttgagcatggcctagtgcttaagaataccgcaatcatgaaagacaatgagtgcaaccatccc |
28937578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University