View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_low_28 (Length: 214)
Name: NF16065_low_28
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 55452807 - 55452626
Alignment:
| Q |
1 |
gtaatgaaacaattccatcattggaaaacaaaataaaatgaattacaactttattatatttatacatctccctttccannnnnnnctctcactcttatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55452807 |
gtaatgaaacaattccatcattggaaaacaaaataaaatgaattacaactttat---atttatacatctccctttccttttttttctctcactcttatag |
55452711 |
T |
 |
| Q |
101 |
tcttattatctttcttttttcttccctatattgtgcaagcatcaaagatgcactcccccttgtcttagccccctcccctaaattat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55452710 |
tcttattatctttcttttttcttccctatattgtgcaagcatcaaagatgcact-ccccttgtcttagccccctcccctaaattat |
55452626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University