View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16065_low_29 (Length: 205)
Name: NF16065_low_29
Description: NF16065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16065_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 116
Target Start/End: Original strand, 410432 - 410530
Alignment:
| Q |
18 |
gaagaagggtgtgagaatcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410432 |
gaagaatggtgtgagaatcatcaatgttgctagaggtggtgttattgatgaagatgctttagtcaaagctcttgatagtggaattgttgctcaggtcaa |
410530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 140 - 190
Target Start/End: Original strand, 410600 - 410650
Alignment:
| Q |
140 |
atttgaaattaatgatttatctgttaaccattcaaatgacatttctatttt |
190 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
410600 |
atttgaaattaattagttatctgttaaccattcaaatgacatttctatttt |
410650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University