View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16066_low_21 (Length: 204)
Name: NF16066_low_21
Description: NF16066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16066_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 37493806 - 37493635
Alignment:
| Q |
15 |
cacagacaatgtcatccgattacaaccgttcaggtaaagataatataattggatttcataatacctttaaatatctggatatttttctttatctggtaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37493806 |
cacagacaatgtcatccgattacaaccgttcaggtaaagataatataattggatttcataatacctttaaatatctggatatttttctttatctggtaaa |
37493707 |
T |
|
| Q |
115 |
cannnnnnnnngaataaatctgataaacattttgtttttagctgaaaaagtcctggacacgaatggccctct |
186 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37493706 |
catttttttttgaataaatctggtaaacattttgtttttagctgaaaaagtcctggacacgaatggccctct |
37493635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University