View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_high_31 (Length: 402)
Name: NF16068_high_31
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 315
Target Start/End: Complemental strand, 4110141 - 4109823
Alignment:
| Q |
17 |
aaaacctccaaacaaacaacgttgtcatagtcacaaccattgatgatagatgctctcccctaacacgtgtcccctccttaaacggcaattgagaatcatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110141 |
aaaacctccaaacaaacaacgttgtcatagtcacaaccattgatgatagatgctctcccctaacacgtgtcccctccttaaacggcaattgagaatcatc |
4110042 |
T |
 |
| Q |
117 |
attcacacacacccaaatcacactctctagtctactatgctatgccatg-----nnnnnnntttgaccactcacaacttcaacaaaaa------------ |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||| ||||| |
|
|
| T |
4110041 |
attcacacgcacccaaatcacactctctagtctactatgctatgccctgcccccccccccctttgaccactcacaactccaaaaaaaacaagataacaac |
4109942 |
T |
 |
| Q |
200 |
-----taataagttgaaaagtcgatttagctcaactgacaataatgatattgttccttattaaaccgaatatttcatcagactctaactcaaaacgtcga |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
4109941 |
aaaaataataagttg--aagtcgatttagctcaactgacaataatgatattgtttcttattaaaccgaatatttcttcagactctaactcgaaacgtcga |
4109844 |
T |
 |
| Q |
295 |
agttgtgtgtgttttatcgac |
315 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4109843 |
agttgtgtgtgttttatcgac |
4109823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 358 - 396
Target Start/End: Complemental strand, 4109780 - 4109742
Alignment:
| Q |
358 |
ctgaggttgaaattgagattaatttccatttcatctcac |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4109780 |
ctgaggttgaaattgagattaatttccatttcatttcac |
4109742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University