View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_high_40 (Length: 356)
Name: NF16068_high_40
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 26 - 135
Target Start/End: Complemental strand, 25143513 - 25143404
Alignment:
| Q |
26 |
ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgccggtgactcctagttattctcccggcggctggtttccatggatgtgctgg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |||||||||| ||| |
|
|
| T |
25143513 |
ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgctggtgactcctagttattctcccgtcggctggttttcatggatgtgttgg |
25143414 |
T |
|
| Q |
126 |
ttttcgtttc |
135 |
Q |
| |
|
|||||||||| |
|
|
| T |
25143413 |
ttttcgtttc |
25143404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 25143340 - 25143280
Alignment:
| Q |
199 |
agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25143340 |
agtttttagacccggatttggatctagatctagatccgttttgtggttgctgctgagaaag |
25143280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 26 - 135
Target Start/End: Complemental strand, 31039611 - 31039502
Alignment:
| Q |
26 |
ttgacctttgcaccagtgtggttttaggaggttgtagcaacagctcgcgccggtgactcctagttattctcccggcggctggtttccatggatgtgctgg |
125 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
31039611 |
ttgacctttgtaccagtgtgattttaggaggttgtagcaacagctcgcaccggtgactcctagttattctcctggcggctggttttcatggatgtgctgg |
31039512 |
T |
|
| Q |
126 |
ttttcgtttc |
135 |
Q |
| |
|
|||||||||| |
|
|
| T |
31039511 |
ttttcgtttc |
31039502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 199 - 260
Target Start/End: Complemental strand, 31039438 - 31039377
Alignment:
| Q |
199 |
agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
31039438 |
agtttttagacccggatttggatctagatctagatccgttttgtggttgctgttgagaaagc |
31039377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 28164531 - 28164590
Alignment:
| Q |
201 |
tttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaagc |
260 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
28164531 |
tttttagacccgaatttgaatctagatctagatccgttttgtggttgctgttgagaaagc |
28164590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 199 - 259
Target Start/End: Complemental strand, 27262427 - 27262367
Alignment:
| Q |
199 |
agtttttagacccggatttggatctagatctagatttgttttgtggttgctgctgagaaag |
259 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||| | | ||||||||||| |
|
|
| T |
27262427 |
agtttttagattcggatttggatctagatctagatcccttttgtgatggttgctgagaaag |
27262367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University