View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_high_69 (Length: 261)
Name: NF16068_high_69
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_high_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 17682620 - 17682384
Alignment:
| Q |
18 |
ttcatcaatttcaaaaggagccccacccctcctttctcgataatcatctccccgtaacggtggctttcatttgctagaaatacgagggatgcggctgcat |
117 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||| ||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17682620 |
ttcatcaatttcaaaaggggccctactcctccttcttcgatgatcatctccccataacggtcgctttcatttgctagaaatacgagggatgcggctgcat |
17682521 |
T |
|
| Q |
118 |
cagaatgatcatccaacgagtcagtacgaaggatggaaatttgttcgcaaatgaaggagacaacgtgcttgtccgctgctatgtcagaaacgaaaagagc |
217 |
Q |
| |
|
||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17682520 |
cagaacgatcctccaacgagtcagtatgaaggatggaaatttgttcgcaaatgaaggagacaacttgcttgtccgctgctatgtcagaaacgaaaagagc |
17682421 |
T |
|
| Q |
218 |
gatggctcttgcagcagtttgttttccttcttctgtg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17682420 |
aatggctcttgcagcagtttgttttccttcttttgtg |
17682384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 180
Target Start/End: Complemental strand, 17666092 - 17665988
Alignment:
| Q |
76 |
ggtggctttcatttgctagaaatacgagggatgcggctgcatcagaatgatcatccaacgagtcagtacgaaggatggaaatttgttcgcaaatgaagga |
175 |
Q |
| |
|
|||||||||||| ||| || || ||||||||||| || || |||||| ||| || |||||| ||||||||||||||||| |||| ||||| ||||| |
|
|
| T |
17666092 |
ggtggctttcatgtgccagtaacacgagggatgcagcggcgtcagaacaatcctctggcgagtcggtacgaaggatggaaatcagttcacaaataaagga |
17665993 |
T |
|
| Q |
176 |
gacaa |
180 |
Q |
| |
|
||||| |
|
|
| T |
17665992 |
gacaa |
17665988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 177
Target Start/End: Original strand, 17699134 - 17699170
Alignment:
| Q |
141 |
gtacgaaggatggaaatttgttcgcaaatgaaggaga |
177 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
17699134 |
gtacgaaggatggaaattagttcacaaatgaaggaga |
17699170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University