View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_high_98 (Length: 204)

Name: NF16068_high_98
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_high_98
NF16068_high_98
[»] chr3 (5 HSPs)
chr3 (40-160)||(43533211-43533332)
chr3 (40-146)||(43528929-43529033)
chr3 (165-204)||(43533312-43533351)
chr3 (88-143)||(43537658-43537715)
chr3 (93-146)||(43523220-43523275)


Alignment Details
Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 40 - 160
Target Start/End: Original strand, 43533211 - 43533332
Alignment:
40 ctgtcaaat-aatttatgtatatgcatgagtgtgattgnnnnnnnnccgttgtgttttacttgctcagtttggagtactcgtcatgttccgatgatcaca 138  Q
    ||||||||| ||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||| |||||||||  ||||||||||    
43533211 ctgtcaaattaatttatgtatatgcatgagtgtgattgttttttttccgttgtgttttacttgctcagtttggagtacccgtcatgtttggatgatcaca 43533310  T
139 attactttataagtgaacgagc 160  Q
    ||||||||||||| ||| ||||    
43533311 attactttataagagaaagagc 43533332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 40 - 146
Target Start/End: Original strand, 43528929 - 43529033
Alignment:
40 ctgtcaaataatttatgtatatgcatgagtgtgattgnnnnnnnnccgttgtgttttacttg--ctcagtttggag--tactcgtcatgttccgatgatc 135  Q
    |||||||||||||||||||||||||||||| |||||          ||||||||||||||||  ||||||||||||  ||||||||||||| |||||||     
43528929 ctgtcaaataatttatgtatatgcatgagtatgatttttt------cgttgtgttttacttgtgctcagtttggagactactcgtcatgtttcgatgatt 43529022  T
136 acaattacttt 146  Q
    |||||||||||    
43529023 acaattacttt 43529033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 43533351 - 43533312
Alignment:
165 cctgtggaggatgtatccagctctttctcttataaagtaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||    
43533351 cctgtggaggatgtatccagctctttctcttataaagtaa 43533312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 143
Target Start/End: Original strand, 43537658 - 43537715
Alignment:
88 ttgtgttttacttgctcagtttggag--tactcgtcatgttccgatgatcacaattac 143  Q
    ||||||||||||||||||||||||||  ||||||||||||| | ||||||||||||||    
43537658 ttgtgttttacttgctcagtttggagactactcgtcatgtttcaatgatcacaattac 43537715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 146
Target Start/End: Original strand, 43523220 - 43523275
Alignment:
93 ttttacttgctcagtttggag--tactcgtcatgttccgatgatcacaattacttt 146  Q
    |||||||||| |||||||||   ||||||||||||| | |||||||||||||||||    
43523220 ttttacttgcgcagtttggaaactactcgtcatgtttcaatgatcacaattacttt 43523275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University