View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_high_98 (Length: 204)
Name: NF16068_high_98
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_high_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 9e-32; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 40 - 160
Target Start/End: Original strand, 43533211 - 43533332
Alignment:
| Q |
40 |
ctgtcaaat-aatttatgtatatgcatgagtgtgattgnnnnnnnnccgttgtgttttacttgctcagtttggagtactcgtcatgttccgatgatcaca |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
43533211 |
ctgtcaaattaatttatgtatatgcatgagtgtgattgttttttttccgttgtgttttacttgctcagtttggagtacccgtcatgtttggatgatcaca |
43533310 |
T |
|
| Q |
139 |
attactttataagtgaacgagc |
160 |
Q |
| |
|
||||||||||||| ||| |||| |
|
|
| T |
43533311 |
attactttataagagaaagagc |
43533332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 40 - 146
Target Start/End: Original strand, 43528929 - 43529033
Alignment:
| Q |
40 |
ctgtcaaataatttatgtatatgcatgagtgtgattgnnnnnnnnccgttgtgttttacttg--ctcagtttggag--tactcgtcatgttccgatgatc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
43528929 |
ctgtcaaataatttatgtatatgcatgagtatgatttttt------cgttgtgttttacttgtgctcagtttggagactactcgtcatgtttcgatgatt |
43529022 |
T |
|
| Q |
136 |
acaattacttt |
146 |
Q |
| |
|
||||||||||| |
|
|
| T |
43529023 |
acaattacttt |
43529033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 43533351 - 43533312
Alignment:
| Q |
165 |
cctgtggaggatgtatccagctctttctcttataaagtaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43533351 |
cctgtggaggatgtatccagctctttctcttataaagtaa |
43533312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 143
Target Start/End: Original strand, 43537658 - 43537715
Alignment:
| Q |
88 |
ttgtgttttacttgctcagtttggag--tactcgtcatgttccgatgatcacaattac |
143 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
43537658 |
ttgtgttttacttgctcagtttggagactactcgtcatgtttcaatgatcacaattac |
43537715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 146
Target Start/End: Original strand, 43523220 - 43523275
Alignment:
| Q |
93 |
ttttacttgctcagtttggag--tactcgtcatgttccgatgatcacaattacttt |
146 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
43523220 |
ttttacttgcgcagtttggaaactactcgtcatgtttcaatgatcacaattacttt |
43523275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University