View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16068_low_110 (Length: 201)

Name: NF16068_low_110
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16068_low_110
NF16068_low_110
[»] chr4 (1 HSPs)
chr4 (83-184)||(32729287-32729388)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 83 - 184
Target Start/End: Complemental strand, 32729388 - 32729287
Alignment:
83 catttgaatcatccgtatggccatcgcctttggcaccatacttaacaacattgaagtaattttggcacaaacaaggtgaagcaatgacaaatattagaca 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
32729388 catttgaatcatccgtatggccatcgcctttggcaccatacttaacaacattgaagtaattttggcacaaacaaggtgaagcaatgacaaatattaggca 32729289  T
183 aa 184  Q
    ||    
32729288 aa 32729287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University