View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_31 (Length: 423)
Name: NF16068_low_31
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_31 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 18 - 403
Target Start/End: Original strand, 4834819 - 4835201
Alignment:
| Q |
18 |
gttgttactcttacaaataagtttctactctctttcaaaaaacttaactttctactcatttttt-actgaatttttcattaattagtnnnnnnnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4834819 |
gttgttactcttacaaataagtttctactctctttcaaaaaacttaactttctactcatttttttactgaatttttcattaattagtccccccctccccc |
4834918 |
T |
|
| Q |
117 |
nnntcattttgcataacatagcaacnnnnnnntcaacatcaagtttttctttaatatatggtaacaaaaacaacagaaaattcaaggttgtcagcgtagg |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4834919 |
c--tcattttgcataacatagcaacaaaaaaatcaacctcaagtttttctttaatat--ggtaacaaaaacaacagaaaattcaaggttgtcagcgtagg |
4835014 |
T |
|
| Q |
217 |
agtaaattgcaacctttcctgcagttgctgaaaagtggcgctcgctctgcgaggaagttgtaggcataccagctattgatgatatagatgccaagcatcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4835015 |
agtaaattgcaacctttcctgcagttgctgaaaagtggcgctcgctctgcgaggaagttgtaggcataccagctattgatgatatagatgccaagcatcc |
4835114 |
T |
|
| Q |
317 |
ttgcgnnnnnnnatatgtccatggcttctctagttgggttccannnnnnngcaacttccagttttggtttcgtagttgcaacctttt |
403 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4835115 |
ttgcgtttttttatatgtccatggcttctctagttgggttccatttttttgcaacttccagttttggtttcgtagttgcaacctttt |
4835201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University