View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_67 (Length: 285)
Name: NF16068_low_67
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 275
Target Start/End: Original strand, 41402190 - 41402452
Alignment:
| Q |
17 |
aagagagacatcaccacctaacttcacttctgccacaaaaaacttgtttcactttattctttcatccatttaaggtttgtgtctcattaatttgtgtatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41402190 |
aagagagacatcaccacctaacttcacttctgccacaaaaaacttgtttcactttattctttcatccatttaaggtttgtgtctcattaatttgtttatt |
41402289 |
T |
 |
| Q |
117 |
cttttgtgtttacttctataacaacggttaaaaaatgaagacttttctg----ttacactatatactatctagctgctttataattgaaataaaccgtca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41402290 |
cttttgtgtttacttctataacaacggttaaaaaatgaagacttttctgttaattacactatatactatctagctactttataattgaaataaaccgtca |
41402389 |
T |
 |
| Q |
213 |
tggttttattatgttatttacatatttactttggtctcacgttataagttttatgtacctatg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41402390 |
tggttttattatgttatttacatatttactttggtctcacgttataagttttatgtatctatg |
41402452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University