View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_72 (Length: 275)
Name: NF16068_low_72
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 10090550 - 10090307
Alignment:
| Q |
19 |
atatagaacttgtagagggtcttcttcaaccttgtgatgcttaggttagcaacatccttcttcacaacatactttgccacaatggatcagtggcttccat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
10090550 |
atatagaacttgtagagggtcttcttcaaccttgtgatgcttaggttaacaacatccttcttcacaatatactttgccacaatggatctgtggcttccat |
10090451 |
T |
 |
| Q |
119 |
atgaaccagcaacagcgacagcctttgcagaaaaatgtcaataacagttactttaagcttaatcaattcttgaatgtcattagaaattaatgataacaat |
218 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10090450 |
atgaaccagcaacagcgacaacctttgcagaaaaatgtcaataacagttactttgagcttaatcaaatcttgaatgtcattagaaattaatgataacaat |
10090351 |
T |
 |
| Q |
219 |
gagtgcaaaaacataatttaccttgaggataatataccatgttc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10090350 |
gagtgcaaaaacataatttaccttgaggataataaaccatgttc |
10090307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University