View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_83 (Length: 249)
Name: NF16068_low_83
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_83 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 10102377 - 10102156
Alignment:
| Q |
1 |
taaatactagactaaaatggaacaatgcaaagagcctaagaaaaaa-ggatatctatatgattcagtattattaattaagtgaatgttttaccttatttc |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10102377 |
taaatactagactaaaaaggaacaatgcaaagagcctaagaaaaaaaggatatctatatgattcagtatta---attaagtgaatgttttaccttatttc |
10102281 |
T |
 |
| Q |
100 |
tactccttccactaataatggcagtaggaaaataactagcaacttcacgcacagctgcacgcatctgtatttgaaatacattcacaattaagctttagag |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10102280 |
tacttcttccactaataatggcagtaggaaaataactagcaacttcacgcacagctgcacgcatctgtatttgaa----attcacaattaagctttagag |
10102185 |
T |
 |
| Q |
200 |
caaataaattcaacatgagtactcacggt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10102184 |
caaataaattcaacatgagtactcacggt |
10102156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University