View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_86 (Length: 245)
Name: NF16068_low_86
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_86 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 104 - 239
Target Start/End: Original strand, 17115523 - 17115658
Alignment:
| Q |
104 |
atctttgttcgaatacatatgatctaattaacaccagatcaataaactagaagtgaatccaaaatgcctataatatgtagttttacttgtgttaatcatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
17115523 |
atctttgttcgaatacatatgatctaattaacaccagatcaataaactagaatttaatccaaaatgtgtatattatgtagttttacttgtgttaatcatt |
17115622 |
T |
|
| Q |
204 |
ttccaaaataagttgtatcaatcatattcatctctc |
239 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||| |
|
|
| T |
17115623 |
tttcaaaataagttgtatcaatcatattcatatctc |
17115658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 62 - 106
Target Start/End: Original strand, 17115450 - 17115494
Alignment:
| Q |
62 |
taatatcatcggagtgttacctccgccatgagctatcatagcatc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17115450 |
taatatcatcggagtgttacctccgccatgagctatcatagcatc |
17115494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University