View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16068_low_88 (Length: 244)
Name: NF16068_low_88
Description: NF16068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16068_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 40483192 - 40483418
Alignment:
| Q |
17 |
acatagaccctcttgttatttccaattcacactaaaatgtctttctttgcccccacgtgcaacacaccatagaacagtgaaccactgaataccacagtta |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40483192 |
acatggaccctcttgttatttccaattcacactaaaatgtctttctttacccccacgtgcaacacaccatagaacagcgaaccactgaataccacagtta |
40483291 |
T |
 |
| Q |
117 |
atgttccatactcaaagccaaacaaacatcacactaacagatacaaaagaaaatcttttgtggacaatccatcacaaaagactccctcatatataacata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40483292 |
atgttccatactcaaagccaaacaaacatcacactaacagatacaaaaaaaaatcttttgttgacaatccatcacaaaagactccctcatatataacata |
40483391 |
T |
 |
| Q |
217 |
tatattaatgcgtacacgaccatagga |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40483392 |
tatattaatgcgtacacgaccatagga |
40483418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University