View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_high_18 (Length: 276)
Name: NF1606_high_18
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 39943182 - 39943445
Alignment:
| Q |
1 |
atataatttggccatccaacttgtatgttgtataataatataatatagatgtactaatctatttgatgcatgatataaactagggatcaaccagtaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39943182 |
atataatttggccatccaacttgtatgttgtataataatataatatagatgtactaatctatttgatgcatgatataaactagggatcaaccagtaattt |
39943281 |
T |
 |
| Q |
101 |
ttcttatctataaccaccagaatttcactttgcaaacattgtttgcggttttgcttttatggatgacacagggaatcctgaaggtttgggcgctgattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
39943282 |
ttcttatctataaccaccagaatttcactttgcaaacattgtttgcggttttgcttttatggatgacacagggaatcctgaaggtttgggcgctgagtta |
39943381 |
T |
 |
| Q |
201 |
ttggaaactctagtgaagatggctccgacaaaggaggaggagataaaactaaaaaattatgatg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39943382 |
ttggaaactctagtgaagatggctccgacaaaggaggaggagataaaactaaaaaattatgatg |
39943445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 262
Target Start/End: Complemental strand, 5491085 - 5490991
Alignment:
| Q |
168 |
acagggaatcctgaaggtttgggcgctgatttattggaaactctagtgaagatggctccgacaaaggaggaggagataaaactaaaaaattatga |
262 |
Q |
| |
|
||||||| ||||||||||||||| ||||| |||||||||| ||||| ||||||||||| || || ||||| ||||||||| | ||||| ||||| |
|
|
| T |
5491085 |
acagggagtcctgaaggtttgggtgctgagctattggaaaccctagtaaagatggctcctactaaagaggaagagataaaattgaaaaactatga |
5490991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University