View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_high_24 (Length: 235)
Name: NF1606_high_24
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 30 - 219
Target Start/End: Complemental strand, 26491953 - 26491764
Alignment:
| Q |
30 |
caccattcatgtatgtattgcagttagagaagcagaagaactagactggggaatgagaaagaggatagctatgggaatagcttactgtctagaccacatg |
129 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491953 |
caccattcatgtatatattgcagttagagaagcagaagagctagactggggaatgagaaagaggatagctatgggaatagcttactgtctagaccacatg |
26491854 |
T |
|
| Q |
130 |
catcaactcacaccacccatttcccacagaaatctgttatcttcttctatatacctcactgaagattatgctgctaaaatatcagacctt |
219 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26491853 |
cataatctcacaccacccatttcccacagaaatctgttatcttcttctatatacctaactgaagattatgctgctaaaatatcagacctt |
26491764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University