View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_high_25 (Length: 235)
Name: NF1606_high_25
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 2 - 123
Target Start/End: Complemental strand, 12698614 - 12698495
Alignment:
| Q |
2 |
attatgctacctttcaaaagaaaaagttaactattatactacgaattttttcaggcaggcaagcgaattttttggatcaattttatagtgcaaaaaaata |
101 |
Q |
| |
|
||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12698614 |
attatactacctttcaaaa-aaaaagtttactattatactacgaattttttcaggcaggcaagcgaattttttggatcaattttatagtgcaaaaaaa-a |
12698517 |
T |
|
| Q |
102 |
ataataaatccacattgctgtt |
123 |
Q |
| |
|
||||||||| |||||||||||| |
|
|
| T |
12698516 |
ataataaatgcacattgctgtt |
12698495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University