View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_low_18 (Length: 294)
Name: NF1606_low_18
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 23452575 - 23452309
Alignment:
| Q |
18 |
atcttaaaaaagttccacccagagctaattttgagaggtgggggattatggatagtaatgaataatgatcaagtttgcgttagtggtt----atggtgag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
23452575 |
atcttaaaaaagttccacccagagctaattttgcgaggtgggggattatggatagtaatga-------tcaagtttgcgttagtggttggttatggtgag |
23452483 |
T |
 |
| Q |
114 |
gggaaatccgttgatcacctagttttgaatgtctgttttttcctcaagagtttggtacgtaaaagcaaattggttaggatttagcatggcgttttcagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23452482 |
gggaaatccgttgatcacctagttttgaatgtctgttttttcctcaagagtttggtacgtaaaagcaaattggttaggatttagcatggcgttttcagaa |
23452383 |
T |
 |
| Q |
214 |
gagggtggaaatcatttaagttctttctcaggtctagtgtagccattcatcaatctcctaaaatgtctctgctc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23452382 |
gagggtggaaatcatttaagttctttctcaggtctagtgtagccattcatcaatctcctaaaatgtctctgctc |
23452309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University