View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1606_low_19 (Length: 280)

Name: NF1606_low_19
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1606_low_19
NF1606_low_19
[»] chr3 (1 HSPs)
chr3 (123-271)||(36344748-36344898)
[»] chr2 (1 HSPs)
chr2 (205-240)||(8369971-8370006)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 123 - 271
Target Start/End: Original strand, 36344748 - 36344898
Alignment:
123 actatagtgtgttagtgtctatgtatatcatagtaattataagctatgatacatgtatttggtgtgtgctacactttggtaccatttttggatatgttat 222  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36344748 actatagtgtgttagtgtctatgtatatcattgtaattataagctatgatacatgtatttggtgtgtgctacactttggtaccatttttggatatgttat 36344847  T
223 gaatcatttttggaattttcaaa--tgtgtgtttcgatttatcacaggttc 271  Q
    |||||||||||| ||||||||||  ||||||||| ||||| ||||||||||    
36344848 gaatcatttttgaaattttcaaatgtgtgtgttttgatttttcacaggttc 36344898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 8370006 - 8369971
Alignment:
205 catttttggatatgttatgaatcatttttggaattt 240  Q
    ||||||||||||||||||||||||||||| ||||||    
8370006 catttttggatatgttatgaatcatttttagaattt 8369971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University