View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_low_19 (Length: 280)
Name: NF1606_low_19
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 123 - 271
Target Start/End: Original strand, 36344748 - 36344898
Alignment:
| Q |
123 |
actatagtgtgttagtgtctatgtatatcatagtaattataagctatgatacatgtatttggtgtgtgctacactttggtaccatttttggatatgttat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36344748 |
actatagtgtgttagtgtctatgtatatcattgtaattataagctatgatacatgtatttggtgtgtgctacactttggtaccatttttggatatgttat |
36344847 |
T |
|
| Q |
223 |
gaatcatttttggaattttcaaa--tgtgtgtttcgatttatcacaggttc |
271 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||| |||||||||| |
|
|
| T |
36344848 |
gaatcatttttgaaattttcaaatgtgtgtgttttgatttttcacaggttc |
36344898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 205 - 240
Target Start/End: Complemental strand, 8370006 - 8369971
Alignment:
| Q |
205 |
catttttggatatgttatgaatcatttttggaattt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8370006 |
catttttggatatgttatgaatcatttttagaattt |
8369971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University