View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_low_22 (Length: 257)
Name: NF1606_low_22
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 43134143 - 43133912
Alignment:
| Q |
8 |
agattatacttaattatcaaccgggtttttacatataaatttacatttaccttctttaaaagacactagtgaggagctgcaatctatgtctttcaaatcc |
107 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| ||| | |
|
|
| T |
43134143 |
agattttacttaattatcaaccgagtttttacatataaatttacatttaccttctttaaaagacactagcgaggggctgcaatctatgtctttcgaat-c |
43134045 |
T |
 |
| Q |
108 |
taatgcatgacgttttaccacaagagttggtcttaatgtaaattctagtgattagcatattctctttaactctgattggatccaaatcgagagnnnnnnn |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43134044 |
taatgcatgacattttaccacaagagttggtcttaatgtaaattatagtgattagcgtattctctttaactttgattggatccaaatcgagagaaaaaaa |
43133945 |
T |
 |
| Q |
208 |
gtattcgtatttgaaatgactaaaatacccaac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43133944 |
gtattcgtatttgaaatgactaaaatacccaac |
43133912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University