View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_low_23 (Length: 249)
Name: NF1606_low_23
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 27509335 - 27509092
Alignment:
| Q |
1 |
taaggctgcatcaattttatttagtgaagatcttaagaacagttatgcatttgcatgcctcacacgttaataattcaactttattagtagtattttggat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27509335 |
taaggctgcatcaattttagttagtgaagatcttaagaacagttatgcatttgcatgcctcacacgttaataattcaactttattagtagtattttggat |
27509236 |
T |
 |
| Q |
101 |
tgtagtcctcattcactggtctcatttccat------------tgctgaatctctcgttcgtgctaaatttcagtaactgttcagacatataatgatgaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
27509235 |
tgtagtcctcattcactggtctcatttccattgctttattgcttgctgaatctctcgttcgtgctaaatttcagtaactgttcag-cacataatgatgaa |
27509137 |
T |
 |
| Q |
189 |
tgatgaaaaacactagccatgtttttccataaactaggttctttt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27509136 |
tgatgaaaaacactagccatgtttttccataaaataggttctttt |
27509092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University