View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1606_low_25 (Length: 245)
Name: NF1606_low_25
Description: NF1606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1606_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 17 - 172
Target Start/End: Complemental strand, 2244776 - 2244629
Alignment:
| Q |
17 |
cacagatgatatatagccacccaatttcgtccataagagcacatgggttgtgcgggtggcggtttgaacgggtggtaagcgactcaaatacttcacacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244776 |
cacagatgatatatagccacccaatttcgtccat----------gggttgtgcgggtggcggtttgaacgggtggtaagcgactcaaatacttcacacac |
2244687 |
T |
 |
| Q |
117 |
--gttcgatctctgacttttccgtatgaaaaaatctgatttacagaggagaatatatc |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2244686 |
acgttcgatctctgacttttccgtatgaaaaaatctgatttacaaaggagaatatatc |
2244629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University