View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1607-INSERTION-4 (Length: 471)
Name: NF1607-INSERTION-4
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1607-INSERTION-4 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 321; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 114 - 471
Target Start/End: Original strand, 32060614 - 32060971
Alignment:
| Q |
114 |
agttcatgtttttcaacactcattcattttgaacactgcaggggaatcaaaaagatgaaagacactcttccctcaaaaaccctcaaggaaaaactacccg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060614 |
agttcatgtttttcaacactcattcattttgaacactgcagaggaatcaaaaagatgaaagacactcttccctcaaaaaccctcaaggaaaaactacccg |
32060713 |
T |
|
| Q |
214 |
agttcttgcaacaatgcgccaaaacattcgagctcgatcgacgttacagaaacgatttacgttatcttcgtgtttggctccacttggtaattgaatcaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060714 |
agttcttgcaacaatgcgccaaaacattcgagctcgatcgacgttacagaaacgatttacgttatcttcgtgtttggctccacttggtaattgaatcaaa |
32060813 |
T |
|
| Q |
314 |
tcacccttgttgaaattttttgaatttgcgaaatggattttgggaaattgttattaaagttcgaatttttagtgttattgtgttggattttgtgattagg |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060814 |
tcacccttgttgaaattttttgaatttgcgaaatgagttttgggaaattgttattaaagtttgaatttttagtgttattgtgttggattttgtgattagg |
32060913 |
T |
|
| Q |
414 |
ttgaaattaaggaataatgaaatgtttagtgannnnnnnctgcgtgattggtagatgg |
471 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32060914 |
ttgaaattaaggaataatgaaatgtttagtgatttttttctgcgtgattggtagatgg |
32060971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 7 - 82
Target Start/End: Original strand, 32060513 - 32060588
Alignment:
| Q |
7 |
actcttatcttcctcattctcagatattaactcatacaccggcaaagaccctcttctcccttggctccggtaatct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060513 |
actcttatcttcctcattctcagatattaactcatacaccggcaaagaccctcttctcccttggctccggtaatct |
32060588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University