View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1607-INSERTION-5 (Length: 245)
Name: NF1607-INSERTION-5
Description: NF1607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1607-INSERTION-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 28449725 - 28449931
Alignment:
| Q |
7 |
atgactagcatgaatcgttcaattatacttacttggaatcaaagtacagtgctattgattaattcatagaaatagctgattctaggaaattaagtgatct |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28449725 |
atgactagcatgaatcgttcaattatacttacttggaatcaaattacagtgctattgattaattcatagaaatagctgattccaggaaattaagtgatct |
28449824 |
T |
|
| Q |
107 |
aataaagttgatcattgggcgtattttcaattaagtggctgcctaannnnnnnattgatatttgacttgaatttaaagttgaagaaatacatgttgtctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28449825 |
aataaagttgatcattgggcgtattttcaattaagtggctgcctaatttttttattgatatttgatttgaatttaaagttgaagaaatacatgttgtctt |
28449924 |
T |
|
| Q |
207 |
tatagta |
213 |
Q |
| |
|
||||||| |
|
|
| T |
28449925 |
tatagta |
28449931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University