View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16070_low_6 (Length: 326)
Name: NF16070_low_6
Description: NF16070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16070_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 17774239 - 17774452
Alignment:
| Q |
14 |
ttctatacaaaatgaataaagagaactcgttatgacactaccnnnnnnnccatcgttgccaattttgttagtagacttcttcacaccatcatnnnnnnnt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
17774239 |
ttctatacaaaatgaataaagagaactcgctatgacaataccaaaaaaaccatcgttgccaattttcttagtagacttcttcacaccatcataaaaaaat |
17774338 |
T |
 |
| Q |
114 |
ggaagaagaagaagaagcactaatcaacaatctcccacaagacacacttcacaaaattttctccactttaccatttcgtcaaatcattttctgccgatca |
213 |
Q |
| |
|
| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17774339 |
g---gaagaagaagaagtactaatctacaatctcccacaagacacacttcacaaaattttctccactttaccatttcgtcaaatcattttctgccgatca |
17774435 |
T |
 |
| Q |
214 |
ctttcaaaattcttcaa |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17774436 |
ctttcaaaattcttcaa |
17774452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University