View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16070_low_8 (Length: 311)
Name: NF16070_low_8
Description: NF16070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16070_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 12583738 - 12583475
Alignment:
| Q |
1 |
tgagtgtaaatattttccagtcaatcataatcatcacttaatgataaacattcatgatgaatgcatccactaattgtgatttgtgtaaaattatttacac |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12583738 |
tgagtgtaaatattttccggtcaatcataatcatcacttaataataaacattcatgatgaatgcatccactaattgtgatttgtgtaaaattatttacac |
12583639 |
T |
 |
| Q |
101 |
tgacatgactggttgtgatttgtgtaaaattacttgcattgacggtacaannnnnnngcattgatagtattaaaatcaacctctaatca-ttttatttgc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12583638 |
tgacatgactggttgtgatttgtgtaaaattacttgcattgacggtacaatttttttgcattgatagtattaaaatcaacctctaatcatttttatttgc |
12583539 |
T |
 |
| Q |
200 |
ttttcaaatatgcagcacggtgttgggatcctatgcacacttcatgtgggaagcagaagaggag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
12583538 |
ttttcaaatatgcagcacggtgttgggatcctatgcacacttcatgtgggaagcggaggaggag |
12583475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University