View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16073_high_18 (Length: 262)
Name: NF16073_high_18
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16073_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 35812405 - 35812580
Alignment:
| Q |
16 |
atagtattgtatttgagtcgttggtaacaaaatatacaaaagaattggatcaataattgcaagtttattttcactattaaatcaatatgccggtcttatt |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
35812405 |
atagtattgtatttgagtcgttggttacaaaatatacaaaagaattggatgaataattgcaaatttattttcaatattaaatcaataagccggtcttatt |
35812504 |
T |
|
| Q |
116 |
tttctcatgttctctctgccaatttctttattgaatggggtggtttcaagtcaattttttacttgaaatatccctt |
191 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35812505 |
tttctcatgttgtctctgccaatttctttattgaatggggtggtttcaagtcaattttttacttgaaatatccctt |
35812580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University