View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16073_high_22 (Length: 231)
Name: NF16073_high_22
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16073_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 4388365 - 4388425
Alignment:
| Q |
156 |
gattgtgacctaacaaatatgaccgaaaggacaacattaattgaattaattaggagctatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388365 |
gattgtgacctaacaaatatgaccgaaaggacaacattaattgaattaattaggagctatc |
4388425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 44685011 - 44684952
Alignment:
| Q |
18 |
ttaggtagggttttggtgcttcatttttctatctttagttattaagttatctaaacaaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44685011 |
ttaggtagggttttggtgcttcatttttctatatttagttattaagttatctaaacaaaa |
44684952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University