View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16073_high_6 (Length: 383)
Name: NF16073_high_6
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16073_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 34 - 367
Target Start/End: Original strand, 33903044 - 33903373
Alignment:
| Q |
34 |
tatttaacataaaaatggatgctgcattatttggacactttctttgattactccctccattctttttacttttgacttgactatgaaggtatgattaaac |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33903044 |
tatttaacataaaaatggatgctgcattatttggacactttctttgattactccc-ccattctttttacttttgacttgactatgaaggtgtgattaaac |
33903142 |
T |
 |
| Q |
134 |
cgctatagttaattgattagcgtgagggatgacagcaatcaattatataaatttgattgacaacgcataaacattatttggnnnnnnncttgccatcttt |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
33903143 |
cgctgtagttaattgattagcgtgagggatgacagcaatcaattatataaatttgattgacaacgcataaac---atttggtttttttcttgccatcttt |
33903239 |
T |
 |
| Q |
234 |
gtagttattacattagtgaaggcaatcaacagcacacatatatagacgaatgattaagactggctaactgaattgaataatatggatattatatgtcttt |
333 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33903240 |
gtagtgattacattagtgaaggcaatcaacagcacacatatatagacgaatgattaagactggctaactgaattgaataatatggatactatatgtcttt |
33903339 |
T |
 |
| Q |
334 |
tcaatgtatgtatatatgtgcatatggaataaag |
367 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
33903340 |
tcaatgcatgtatatatgtgcatatggaataaag |
33903373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 2 - 40
Target Start/End: Original strand, 33902980 - 33903018
Alignment:
| Q |
2 |
tgagatttaaacatagactctctacttctccatatttaa |
40 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
33902980 |
tgagatttaaacatagactctttacttcttcatatttaa |
33903018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University