View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16073_low_16 (Length: 294)
Name: NF16073_low_16
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16073_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 125 - 277
Target Start/End: Complemental strand, 17770993 - 17770841
Alignment:
| Q |
125 |
ctgtcagccgaaatcaaaaggttacaagctcaaaaagacaccatttatcattaattgtttcaactttctgttttaccacatcctttctttctgttatata |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
17770993 |
ctgtcagccgaaatcaaaaggttacaagctcaaaaagacaccatttatcattatttgtttcaactttctattttaccacatcctttctttcttttatata |
17770894 |
T |
 |
| Q |
225 |
aatcacttttcctcacttgcttctctcttaaatctcttcaccctctatcacaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17770893 |
aatcacttttcctcacttgcttctctcttaaatctcttcaccctctatcacaa |
17770841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 61
Target Start/End: Complemental strand, 17771104 - 17771057
Alignment:
| Q |
14 |
caaaaccaaccagcaccctgcagaaagccatcgctgtccgtcccaaca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17771104 |
caaaaccaaccagcaccctgcagaaagccatcgttgtccgtcccaaca |
17771057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 172 - 241
Target Start/End: Complemental strand, 41066821 - 41066752
Alignment:
| Q |
172 |
tcattaattgtttcaactttctgttttaccacatcctttctttctgttatataaatcacttttcctcact |
241 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41066821 |
tcattaattgtcccaactttctgttttacaacatcctttctttcttttatataaatcacttttcctcact |
41066752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 276
Target Start/End: Complemental strand, 41066729 - 41066700
Alignment:
| Q |
247 |
ctctcttaaatctcttcaccctctatcaca |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41066729 |
ctctcttaaatctcttcaccctctatcaca |
41066700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University