View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16073_low_25 (Length: 217)
Name: NF16073_low_25
Description: NF16073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16073_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 22 - 137
Target Start/End: Original strand, 4845782 - 4845897
Alignment:
| Q |
22 |
aaatgtatcagtagtgattacaattattgtgaagaatcaaaatcaaatgcagtcaatgccgcctcaatcgcgacaacattgtagtttcaacaacaacaac |
121 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4845782 |
aaatgtattagtagtgattataattattgtgaagaatcaaaatcaaatgcagccaatgccgcatcaatcatgacaacattgtagtttcaacaacaacaac |
4845881 |
T |
|
| Q |
122 |
aaaaaccattatatca |
137 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
4845882 |
aaaaaccattacatca |
4845897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 112 - 217
Target Start/End: Original strand, 4846338 - 4846443
Alignment:
| Q |
112 |
caacaacaacaaaaaccattatatcacagcttggattgaagtctcgggcctttatttaaaacccttcaatagtgtgctcatcttcttctagaatcacaaa |
211 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||| | |||| ||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
4846338 |
caacagcaacaaaaaccattatatcacggcttggatcgcagtcacgggcctttatttaaaacccttcaataatttgctcatcttcttctagaatcacaaa |
4846437 |
T |
|
| Q |
212 |
acaatt |
217 |
Q |
| |
|
|||||| |
|
|
| T |
4846438 |
acaatt |
4846443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 171 - 217
Target Start/End: Original strand, 4834872 - 4834918
Alignment:
| Q |
171 |
aacccttcaatagtgtgctcatcttcttctagaatcacaaaacaatt |
217 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
4834872 |
aacccttcaatagtttgttcatcttcatctagaatcacaaaacaatt |
4834918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 4835948 - 4836005
Alignment:
| Q |
160 |
cctttatttaaaacccttcaatagtgtgctcatcttcttctagaatcacaaaacaatt |
217 |
Q |
| |
|
|||||||||||||||| ||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
4835948 |
cctttatttaaaacccctcaattattcgctcattttcttctagaatcacaaaacaatt |
4836005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University