View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16074_high_2 (Length: 443)
Name: NF16074_high_2
Description: NF16074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16074_high_2 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 170 - 443
Target Start/End: Original strand, 39466356 - 39466630
Alignment:
| Q |
170 |
gtcagtaaaaatcaacaacatgcatgcaatcttagattatt-gtttgattttgattcttctggaactgtttattacttcatcattcactttcacctacaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39466356 |
gtcagtaaaaatcaacaacatgcatgcaatcttagattatttgtttgattttgattcttctggaactgtttattacttcatcattcactttcacctacaa |
39466455 |
T |
 |
| Q |
269 |
agtttaaacctttacccctgtactgtttatttacattgctattgttcttagtgtttagtttataatttcattttgattccggaactgtagtgtacaactt |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
39466456 |
agtttaaacctttacccctgtactgtttatttacattgctattgttctcagagtttagtttatagtttcattttgattccggaactgtagtgtacaactt |
39466555 |
T |
 |
| Q |
369 |
catcattctgtttcacctaggaatttgaaacctttacccctatagttttatatttttcaattcaagaaccttatt |
443 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39466556 |
catcattctgtttcaccaaggaatttgaaacctttacacctatagttttatatttttcaattcaagaaccttatt |
39466630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University