View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16074_low_14 (Length: 280)
Name: NF16074_low_14
Description: NF16074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16074_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 30051292 - 30051025
Alignment:
| Q |
1 |
tcttgctcccttcaattgtggtgcacctccactatcctttccacttgatgcccaggatgctggaagaaaaatgtgtcgtataaacaaagttgataaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30051292 |
tcttgctcccttcaattgtggtgcacctccactatcctttccacttgatgcccaggatgctggaagaaaaatgtgtcgtataaacaaagttgataaaagt |
30051193 |
T |
|
| Q |
101 |
taacaagaaaatcaaagtgcgaatgttgtttcattaccaaatggtctacttattccaatggctctctctgcacgcttcttttgcaggattgcatacacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30051192 |
taacaagaaaatcaaagtgcgaatgttgtttcattaccaaatggtctacttattccaatggctctctctgcacgcttcttttgccggattgcatatacca |
30051093 |
T |
|
| Q |
201 |
ttaaccctacaaggcacaaaatcaaagttgtgcttccagctgttatcccaataatagtacctatgcta |
268 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30051092 |
ttaaccctacgaggcacaaaatcaaagttgtgcttccagctgttatcccaataatagtacctatgcta |
30051025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 133 - 195
Target Start/End: Complemental strand, 30035072 - 30035010
Alignment:
| Q |
133 |
attaccaaatggtctacttattccaatggctctctctgcacgcttcttttgcaggattgcata |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30035072 |
attaccaaatggtctacttattccaatggctctctctgcgcgcttcttttgcaggatagcata |
30035010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 5 - 63
Target Start/End: Complemental strand, 30035203 - 30035145
Alignment:
| Q |
5 |
gctcccttcaattgtggtgcacctccactatcctttccacttgatgcccaggatgctgg |
63 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
30035203 |
gctcctttcaattgtggtgcacctccactgtcctttccacttggtgcccaggatgctgg |
30035145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University