View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16074_low_4 (Length: 373)
Name: NF16074_low_4
Description: NF16074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16074_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 19 - 358
Target Start/End: Original strand, 21376317 - 21376656
Alignment:
| Q |
19 |
caaacaaccaggaatttcatctggaaaggttcaaatgataaaggcatttatctggtaggttggaaaaaactacccgtcccatgactcttggtggcctttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376317 |
caaacaaccaggaatttcatctggaaaggttcaaatgataaaggcattcatctggtaggttggaaaaaactacccgtcccatgactcttggtggcctttg |
21376416 |
T |
|
| Q |
119 |
aatcaggagagccagggaattgaatacttgccttcttggaaagcttgtttgggatttgatccaatcatctgaaaaactttgggtcagtatcctctctaac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376417 |
aatcaggagagccagggaattgaatacttgccttcttggaaagcttgtttgggatttgatccaatcatctgaaaaactttgggtcagtatcctctctaac |
21376516 |
T |
|
| Q |
219 |
aaatatgtggttggtcataacatccttcaagcaactaataattcgaacaactctccaatttggtcctcaattatcaaagctaaaaatgcccttaaagtgg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376517 |
aaatatgtggttggtcataacatccttcaagcaactaataattcgaacaactctccaatttggtcctcaattatcaaagctaaaaatgcccttaaagtgg |
21376616 |
T |
|
| Q |
319 |
gatactcttggtgtgtcgggtccgtttcttcatccctttg |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21376617 |
gatactcttggtgtgtcgggtccgtttcttcatccttttg |
21376656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University