View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16074_low_6 (Length: 360)
Name: NF16074_low_6
Description: NF16074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16074_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 36800413 - 36800105
Alignment:
| Q |
1 |
aatacatgatcataatcaaatttcttttggaatgatgcaatcttcttcatcaccctctgtccttggaaactacatgtgagttctttctcaattatgnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800413 |
aatacatgatcataatcaaatttcttttggaatgatgcaatcttcttcatcaccctctgtccttggaaactacatgtgagttctttctcaattatgtata |
36800314 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnncgagatgaagtgatgaacaattaactgtgtcttacgttnnnnnnnnttggtttattttgttattataacnnnnnnnnnnnnnnnnna |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
36800313 |
tatatat------cgagatgaagtgatgaacaattaactgtgtcttacgttaaaaaaaattggtttattttgttattataacttttttgttttttgttta |
36800220 |
T |
 |
| Q |
201 |
tgtcagcagaaataaagattctggagcttatgatttgggtgaattagatcaagccctttttctctatcttaatggacaaactgacccatccagtgttcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800219 |
tgtcagcagaaataaagattctggagcttatgatttgggtgaattagatcaagccctttttctctatcttaatggacaaactgacccatccagtgttcaa |
36800120 |
T |
 |
| Q |
301 |
gaccaaaaacgtgag |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36800119 |
gaccaaaaacgtgag |
36800105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University