View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16075_high_15 (Length: 295)
Name: NF16075_high_15
Description: NF16075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16075_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 25 - 279
Target Start/End: Original strand, 29024132 - 29024386
Alignment:
| Q |
25 |
agtagatatgcatgtaagatacaaacaatgtgaattaaaatctagatgaatatataacacaaaagtttgctttatttctatgtcacggggtttgataatc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29024132 |
agtagatatgcatgtaagatacaaacaatgtgaattaaaatctagatcaatatataacacaaaagtttgctttatttctatgtcacggggtttgataatc |
29024231 |
T |
 |
| Q |
125 |
aattcaattaattgccttacctatattttgatcacttttggatttttaacaactggcaacaagaaattatatctagctactagagccacctgtcatttaa |
224 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29024232 |
aattcaattaattcccttacctatatttttatcacttttggatatttaacaactggcaacaagaaattatatctagctactagagccacctgtcatttaa |
29024331 |
T |
 |
| Q |
225 |
tctatatatcttgtgtgatgttgcattgtattatgacaaaaattaggcatctaat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29024332 |
tctatatatcttgtgtgatgttgcattgtattatgacaaaaattaggcctctaat |
29024386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University