View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16075_low_23 (Length: 221)
Name: NF16075_low_23
Description: NF16075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16075_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 72 - 203
Target Start/End: Original strand, 53192955 - 53193086
Alignment:
| Q |
72 |
ttcactggaataagtagcacagggccaaagatttgatgagttggacttcaagcccacaaatccaggcccagcaactggagctgcaaatgttccagcagac |
171 |
Q |
| |
|
|||| ||||||||||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53192955 |
ttcaatggaataagtagcactgggccaaagacttgatgagttggacttcaagcccacaaagccaggcccagcaactggagctgcaaatgttccagcagac |
53193054 |
T |
 |
| Q |
172 |
attttaatcaaataaatgtctgatctttgaag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53193055 |
attttaatcaaataaatgtctgatctttgaag |
53193086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 19689184 - 19689138
Alignment:
| Q |
24 |
ggcaattctcttgaattaaagtatccatcttaacacaggttctgctc |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
19689184 |
ggcaattctcttgaattaaagtatccatcttaacacagcttcggctc |
19689138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University