View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16076_high_11 (Length: 220)
Name: NF16076_high_11
Description: NF16076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16076_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 49 - 189
Target Start/End: Complemental strand, 8386148 - 8386008
Alignment:
| Q |
49 |
ctctcttgttggaaaactctatcttcactcacccccaattccggtccactcaatttcagttcacctagtttcaattcacccccaatttcgaattttacat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8386148 |
ctctcttgttggaaaactctatcttcactcaccctcaattccggtccactcaatttcagttcacctagtttcaattcatccccaatttcgaattttacat |
8386049 |
T |
|
| Q |
149 |
atacttttaagatccccaatttcttagaaactacaacacaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8386048 |
atacttttaagatccccaatttcttagaaactacaacacaa |
8386008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 60 - 145
Target Start/End: Complemental strand, 27978619 - 27978534
Alignment:
| Q |
60 |
gaaaactctatcttcactcacccccaattccggtccactcaatttcagttcacctagtttcaattcacccccaatttcgaatttta |
145 |
Q |
| |
|
||||||||||||||||||||| ||||||| | || || |||||| ||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
27978619 |
gaaaactctatcttcactcacacccaatttcaatcaaccaaatttcgattcacctagtttcaattaaccctcaatttcgaatttta |
27978534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University