View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16076_low_5 (Length: 359)
Name: NF16076_low_5
Description: NF16076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16076_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 124 - 342
Target Start/End: Complemental strand, 7364547 - 7364329
Alignment:
| Q |
124 |
ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7364547 |
ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagttttgcatcagaaccataaagtttacgagcagcag |
7364448 |
T |
 |
| Q |
224 |
catcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcggatttcagccacccatttacccca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7364447 |
catcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgaatttcagccacccatttacccca |
7364348 |
T |
 |
| Q |
324 |
tgttctctgcctcacacct |
342 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7364347 |
tgttctctgcctcacacct |
7364329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 202 - 341
Target Start/End: Complemental strand, 52690676 - 52690537
Alignment:
| Q |
202 |
ccataaagtttacgagcagcagcatcataagctaaagcagcttcatgagaggtttcaaaagtaccaagccaaagacgagcaccacgattaggttcgcgga |
301 |
Q |
| |
|
|||||||| ||| | || |||||||||||||| |||||||||||| | || || ||||| || ||||||||||| |||| ||||||||| ||||| |||| |
|
|
| T |
52690676 |
ccataaagcttaagtgcggcagcatcataagccaaagcagcttcaagggatgtctcaaatgtcccaagccaaaggcgagaaccacgattgggttcacgga |
52690577 |
T |
 |
| Q |
302 |
tttcagccacccatttaccccatgttctctgcctcacacc |
341 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
52690576 |
tttcagcaacccatttaccccaagttctctgtctcacacc |
52690537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University