View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16076_low_6 (Length: 297)
Name: NF16076_low_6
Description: NF16076
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16076_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 40085315 - 40085568
Alignment:
| Q |
9 |
gagaagaaagcttaccaatggcagggtcaagtcgaccggttaaaccagctgaaccggctctaggatcaccgaggttgagagaaataaccttatcagaatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085315 |
gagaagaaagcttaccaatggcagggtctaatcgaccggttaaaccagctgaaccggctctaggatcaccgaggttgagagaaataaccttatcagaatc |
40085414 |
T |
|
| Q |
109 |
acaaaacacaccggagaagttgcatggatcagcagtgaaatcccatgaagaaaagaaatcagaaccaggcatgtcttcaagagctttacgaatggattga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085415 |
acaaaacacaccggagaagttgcatggatcagcagtgaaatcccatgaagaaaagaaatcagaaccaggcatgtcttcaagagctttacgaatggattga |
40085514 |
T |
|
| Q |
209 |
agagctagaaaatcagtagggtctaaaatcgcgtttacaataagctgattgtgt |
262 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40085515 |
agagctagaaaatcagcagggtctaaaatcgcgtttacaataagctgattgtgt |
40085568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University