View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_104 (Length: 238)
Name: NF16077_high_104
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 45792906 - 45793114
Alignment:
| Q |
18 |
catgcatgtgtatggtggaaggtttatttgattcaaaggttgtctgaagaacagtaacatactgaagagagaaaaatagtcttggcacttggcagtgaca |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45792906 |
catgcatgtgtatggtggaagttttatttgattcaaaggttgtctgaagaacagtaacatactgaagagaaaaaaatagtcttggcacttggcagtgaca |
45793005 |
T |
|
| Q |
118 |
agcaacataaaatcagggtctgttgataaaaatgaaacatgaccagctcacttgatttatggtataacacaaatattaaaagtagttccatgtattttca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45793006 |
agcaacataaaatcagggtctgttgataaaaatgaaacatgaccagctcacttgatttatggtataacacaaatattaaaagtagttccatgtattttca |
45793105 |
T |
|
| Q |
218 |
aagaataat |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
45793106 |
aagaataat |
45793114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University