View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_107 (Length: 230)
Name: NF16077_high_107
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_107 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 87 - 223
Target Start/End: Complemental strand, 36367736 - 36367602
Alignment:
| Q |
87 |
tatggcacttatgaatgattgggttgatattatgcaatgaatgtaa-ctcannnnnnnnaatatggcacttatcaatgatgtatataatattaaattcta |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36367736 |
tatggcacttatgaatgattgggttgatat---gcaatgaatgtaaactcattttttttaatatggcacttatcaatgatgtatataatattaaattcta |
36367640 |
T |
|
| Q |
186 |
ataaaaagaattttctctgttatatttagcctatgctt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36367639 |
ataaaaagaattttctctgttatatttaccctatgctt |
36367602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University