View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_109 (Length: 227)
Name: NF16077_high_109
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_109 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 212
Target Start/End: Original strand, 27753782 - 27753980
Alignment:
| Q |
14 |
taatacttaaaaagaaaaagaagttaaaggacaaagagatattaatcctttatttaatttagttgttttatatttatttactacaacacatgtcatagtc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27753782 |
taatacttaaaaagaaaaagaagttaaaggacaaagagatattaatcctttatttaatttagttgttttatatttatttactacaacacatgtcatagtc |
27753881 |
T |
 |
| Q |
114 |
acgacgtggatccaaaatcagatctgggtcgaaagcacgtttatgaatgcccctaaggagttgacttggcaaaatgccatttacctaaccaattacatg |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27753882 |
acgacgtggatccaaaatcagatatgggtcgaaagcacgtttatgaatgcccctaaggagttgacttggcaaaatgccatttacctaaccaattacatg |
27753980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University