View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_119 (Length: 203)
Name: NF16077_high_119
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_119 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 55341308 - 55341482
Alignment:
| Q |
18 |
tatataactatccagtttttggattagagacatcataattcatttactaggagcttttttatgcagcagcttctcaactttgagcacagtggttagcatc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55341308 |
tatataactaaccagtttttggattagagacatcataattcatttactaggagcttttttatgcagcagcttctcaactttgagcacagtggttagcatc |
55341407 |
T |
 |
| Q |
118 |
aaaaagacaaaaaccagaacagacacaatacatatcaccagcattaaagcagaggccatactacttttcatctca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55341408 |
aaaaagacaaaaaccagaacagacacaatacatatcaccagcattaaagcagaggccatactacttttcacctca |
55341482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University