View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_38 (Length: 394)
Name: NF16077_high_38
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 18 - 386
Target Start/End: Complemental strand, 28146095 - 28145727
Alignment:
| Q |
18 |
ttcatgttaggcaggatccaatttgatnnnnnnntattcaagcacatcatataaacatcttccttgattatctccaagcatgcttgaaagnnnnnnnctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28146095 |
ttcatgttaggcaggatccaatttgataaaaaaatattcaagcacatcatataaacatcttccttgattatctccaagcatgcttgaaagaaaaaaactt |
28145996 |
T |
|
| Q |
118 |
caaaaccataaggcccaggtgcaacttctttgttcattgaggaaacaatactttttatttcttctcttgtgaaaagagttgtaaaatgagaaaccatatg |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28145995 |
caaaaccataaggccctggtgcaacttctttgttcattgaggaaacaatactttttatttcttctcttgtgaaaagagttgtaaaatgagaaaccatatg |
28145896 |
T |
|
| Q |
218 |
acttttaatctattctggatcagtgatgactctgtcttcaatatttagtgaaactatcttcttataatcttgcgtaatttgagcagttttattgaaaata |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28145895 |
acttttaatctattctggatcagtgatgactctgtctttaatatttagtgaaactatcttcttataatcttgcataatttgagcagttttattgaaaata |
28145796 |
T |
|
| Q |
318 |
aaatagtgtttctatcccattcacaaaacttcttccatattcagagccttttataaatcaacctttgct |
386 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28145795 |
aaatagtgtttctatcccattcgcaaaacttcttccatattcagagccttttataaatcaatctttgct |
28145727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University