View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16077_high_49 (Length: 342)
Name: NF16077_high_49
Description: NF16077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16077_high_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 92 - 326
Target Start/End: Complemental strand, 2303334 - 2303100
Alignment:
| Q |
92 |
atggggtgtttagttttcagttaatttgtcttgcaccatgtaccaagccagaaactagaagtgttatttggaatcctagcctttcgtgaagcaaatcaag |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2303334 |
atggggtgtttagttttcagttaatttgtcttgcaccatgtaccaagccagaaactagaagtgttatttggaatcctagcctttcgtgaagcaaatcaag |
2303235 |
T |
|
| Q |
192 |
tagccgatactatattcaaaaaatagtttaagaatttagctatgttatgcagatttagcttataatatattctccggtggattttaaatcctattggcag |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2303234 |
tagccgatactatattcaaaaaatagtttaagaatttagctatgttatgcagatttagcttataatatattctccggtggattttaaatcctattggcag |
2303135 |
T |
|
| Q |
292 |
gagggagcttttgcttcctcatgatcaccaataac |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2303134 |
gagggagcttttgcttcctcatgatcaccaataac |
2303100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University